Taok1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Taok1^em1(IMPC)Tcp
• Name: TAO kinase 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7293333
• Gene: Taok1 Location: Chr11:77419988-77498641 bp, - strand Genetic Position: Chr11, 46.64 cM, cytoband B5
• Alliance: Taok1^em1(IMPC)Tcp page
• IMPC: Taok1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GAAAAGCAAATACCGCCGGG targeting the 5' side and AAACATTAAACTAGGCGGTC targeting the 3' side of a critical region (ENSMUSE00000520605) along with a single-strand oligonucleotide encoding a Bxb1 attB site. This resulted in a 1292-bp deletion of Chr11 from 77,465,754 to 77,467,045 (GRCm39) with an insertion of a Bxb1 attB sequence (GGCTTGTCGACGACGGCGGTCTCCGTCGTCAGGATCATACACCGG). (J:265051)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Taok1 Mutation: 45 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)