Ctu1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ctu1^em1(IMPC)J
• Name: cytosolic thiouridylase subunit 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7311988
• Gene: Ctu1 Location: Chr7:43321440-43327722 bp, + strand Genetic Position: Chr7, 28.26 cM
• Alliance: Ctu1^em1(IMPC)J page
• IMPC: Ctu1 gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, GGAGATGGCGTCCTACTGAG and GCAGTCACCCTATTATAGAT, which resulted in a 3606 bp deletion beginning at Chromosome 7 position 43,674,889 bp and ending after 43,678,494 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000279483, ENSMUSE00000401936 (exons 2 and 3) and 1191 bp of intronic sequence including the start site, splice acceptors and donors and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ctu1 Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)