About   Help   FAQ
Rr207em1LinJ
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr207em1LinJ
Name: regulatory region 207; endonuclease-mediated mutation 1, Lin Jiang
MGI ID: MGI:7316892
Synonyms: TBX3 enhancer KO
Gene: Rr207  Location: unknown  Genetic Position: Chr5, Syntenic
Alliance: Rr207em1LinJ page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Single point mutation
 
Mutation detailsAn A-to-G mutation was engineered in this Tbx3 enhancer using sgRNAs (targeting GGCAAGCCAGAGAAACGGGAAGG and GGGAGGTCAGTCATAATTGGCGG) and an ssODN template (GCGTCTGGGAGGTCAGTCGTAATTGGCGGAAGTTT) with CRISPR/Cas9 technology. (J:320102)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr207 Mutation:  0 strains or lines available
References
Original:  J:320102 Liu X, et al., A single-nucleotide mutation within the TBX3 enhancer increased body size in Chinese horses. Curr Biol. 2022 Jan 24;32(2):480-487.e6
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory