Gng12^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gng12^em1(IMPC)J
• Name: guanine nucleotide binding protein (G protein), gamma 12; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7327089
• Gene: Gng12 Location: Chr6:66873381-66998334 bp, + strand Genetic Position: Chr6, 30.68 cM
• Alliance: Gng12^em1(IMPC)J page
• IMPC: Gng12 gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, TCGTCACCAAAATTACTGCA and CCTTCCTCACGCCATCCCTA, which resulted in a 5857 bp deletion beginning at Chromosome 6 position 67,015,601 bp and ending after 67,021,457 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000256838 and ENSMUSE00000698574 (exons 3,4) and 4115 bp of flanking intronic sequence including the splice acceptor start site and splice donor and is predicted to result in a null allele. There is a 2 bp (CT) insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gng12 Mutation: 46 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)