Lkaaear1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lkaaear1^em1(IMPC)J
• Name: LKAAEAR motif containing 1 (IKAAEAR murine motif); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7327094
• Gene: Lkaaear1 Location: Chr2:181338586-181340235 bp, - strand Genetic Position: Chr2, 103.73 cM
• Alliance: Lkaaear1^em1(IMPC)J page
• IMPC: Lkaaear1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, CCACATCTAATGGCACTGAA and AGGACTATAAAACCCGACGA, which resulted in a 1214 bp deletion beginning at Chromosome 2 position 181,696,645 bp and ending after 181,697,858 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000399911, ENSMUSE00000359021 and ENSMUSE00000388487 (exons 2,3 and 4) and 532 bp of intronic sequence including the splice acceptor start site and splice donor and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Lkaaear1 Mutation: 11 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)