Alkal2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Alkal2^em1(IMPC)J
• Name: ALK and LTK ligand 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7328421
• Gene: Alkal2 Location: Chr12:30934323-30943855 bp, + strand Genetic Position: Chr12, 13.0 cM
• Alliance: Alkal2^em1(IMPC)J page
• IMPC: Alkal2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTATCCATACTACAATGCAC and CACTTAGCTGATCTCAGCAG, which resulted in a 3391 bp deletion beginning at Chromosome 12 position 30,886,935 bp and ending after 30,890,325 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000435238, ENSMUSE00000435234 and ENSMUSE00000435241(exons 2, 3 and 4) and 3190 bp of intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 85 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Alkal2 Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)