Ramac^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ramac^em1(IMPC)J
• Name: RNA guanine-7 methyltransferase activating subunit; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7328450
• Synonyms: Ramac^-
• Gene: Ramac Location: Chr7:81412701-81419238 bp, + strand Genetic Position: Chr7, 45.71 cM
• Alliance: Ramac^em1(IMPC)J page
• IMPC: Ramac gene page

Ramac^em1(IMPC)J/Ramac^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos show severe developmental delay as small egg cylinders, poorly organized extraembryonic tissues and failure of gastrulation.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, TCTTGACTACACTACGCTAT and TCATTACCACATAAATAAAT, which resulted in a 2137 bp deletion beginning at Chromosome 7 position 81,767,381 bp and ending after 81,769,517 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000311576 and ENSMUSE00000423698 (exons 2 and 3) and 817 bp of intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ramac Mutation: 12 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)