Ccdc184^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc184^em1(IMPC)J
• Name: coiled-coil domain containing 184; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7330216
• Gene: Ccdc184 Location: Chr15:98065687-98068015 bp, + strand Genetic Position: Chr15, 54.17 cM
• Alliance: Ccdc184^em1(IMPC)J page
• IMPC: Ccdc184 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGACGCTATTTAAAGCGCTG and ATACCCGGCCCGGCTAACAA, which resulted in a 3243 bp deletion beginning at Chromosome 15 position 98,167,142 bp and ending after 98,170,384 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000409713 (exon 1) and 266 bp of flanking sequence including the splice acceptor and donor and start site as well as 3UTR and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ccdc184 Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)