About   Help   FAQ
Msantd3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Msantd3em1(IMPC)J
Name: Myb/SANT-like DNA-binding domain containing 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7330221
Gene: Msantd3  Location: Chr4:48539935-48561919 bp, + strand  Genetic Position: Chr4, 26.13 cM, cytoband B2
Alliance: Msantd3em1(IMPC)J page
IMPC: Msantd3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACATTTTGTAGTATTAGAGT and GTATAAATCCTAACCCCGAT, which resulted in a 9774 bp deletion beginning at Chromosome 4 position 48,552,345 bp and ending after 48,562,118 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000410568 and ENSMUSE00001226920 (exons 2 and 3) and 8248 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Msantd3 Mutation:  39 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory