Igfbp6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Igfbp6^em1(IMPC)J
• Name: insulin-like growth factor binding protein 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7330354
• Gene: Igfbp6 Location: Chr15:102052797-102057946 bp, + strand Genetic Position: Chr15, 57.32 cM
• Alliance: Igfbp6^em1(IMPC)J page
• IMPC: Igfbp6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTACTGGTAGAAGTGGACCT and GGCAGTCTACTGTATTCCAA, which resulted in a 1866 bp deletion beginning at Chromosome 15 position 102,147,772 bp and ending after 102,149,637 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000285923, ENSMUSE00000133145, and ENSMUSE00000444314 (exons 2-4) and 1277 bp of flanking intronic sequence including the splice acceptor, donor as well as 3UTR is predicted to cause a change of amino acid sequence after residue 112 and early truncation 16 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Igfbp6 Mutation: 17 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)