Klhdc8b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Klhdc8b^em1(IMPC)J
• Name: kelch domain containing 8B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7330360
• Gene: Klhdc8b Location: Chr9:108324835-108338780 bp, - strand Genetic Position: Chr9, 59.37 cM, cytoband F2
• Alliance: Klhdc8b^em1(IMPC)J page
• IMPC: Klhdc8b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGGTGGACTTGAGACCCC and GTAACTTGATCAATTTAGAG, which resulted in a 4121 bp deletion beginning at Chromosome 9 position 108,447,537 bp and ending after 108,451,657 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000221526, ENSMUSE00000221528, ENSMUSE00000243289, ENSMUSE00000221530 and ENSMUSE00000221531 (exons 2-6) and 2120 bp of flanking and intronic sequence including the start site, splice acceptors, donors as well as 3 UTR and is predicted to result in a null allele. There is a 4 bp insertion ACCT at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Klhdc8b Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)