Zfp551^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp551^em1(IMPC)J
• Name: zinc finger protein 551; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7330383
• Gene: Zfp551 Location: Chr7:12149080-12156678 bp, - strand Genetic Position: Chr7, 7.5 cM
• Alliance: Zfp551^em1(IMPC)J page
• IMPC: Zfp551 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAATCTCTGAATTCAGAGA and AGATGCTAATGAAGTAATGC, which resulted in a 2174 bp deletion beginning at Chromosome 7 position 12,415,086 bp and ending after 12,417,259 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000479797 (exon 4) and 108 bp of flanking intronic sequence including the splice acceptor and 3 UTR and is predicted to cause a change of amino acid sequence after residue 88 and truncation 20 amino acids later by run on translation. There is a 3 bp insertion ATT at the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp551 Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)