Irgq^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Irgq^em1(IMPC)J
• Name: immunity-related GTPase family, Q; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7331504
• Gene: Irgq Location: Chr7:24230114-24238025 bp, + strand Genetic Position: Chr7, 11.32 cM
• Alliance: Irgq^em1(IMPC)J page
• IMPC: Irgq gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAGTGAATCAGTTAGGAGA and CCATGTGCTTGTCTACGGAG, which resulted in a 7630 bp deletion beginning at Chromosome 7 position 24,531,163 bp and ending after 24,538,792 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000404079 and ENSMUSE00000317876 (exons 2 and 3) and 1763 bp of intronic sequence including the splice acceptor and donor the start site and 3 UTR and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Irgq Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)