Tvp23b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tvp23b^em1(IMPC)J
• Name: trans-golgi network vesicle protein 23B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7331509
• Gene: Tvp23b Location: Chr11:62770281-62786012 bp, + strand Genetic Position: Chr11, 38.81 cM, cytoband B2
• Alliance: Tvp23b^em1(IMPC)J page
• IMPC: Tvp23b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCTTGCAGTGAAGTGTAA and CTGAGCAGTGTTTATGTGAA, which resulted in a 327 bp deletion beginning at Chromosome 11 position 62,883,597 bp and ending after 62,883,923 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001289657 (exon 3) and 182 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 32 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tvp23b Mutation: 17 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)