Smim17^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Smim17^em1(IMPC)J
• Name: small integral membrane protein 17; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7331568
• Gene: Smim17 Location: Chr7:6418193-6434085 bp, + strand Genetic Position: Chr7, 3.71 cM
• Alliance: Smim17^em1(IMPC)J page
• IMPC: Smim17 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAACACTAGAAAGAGAGCA and ATAGACTGTGCATATCCACA, which resulted in a 7666 bp deletion beginning at Chromosome 7 position 6,427,547 bp and ending after 6,435,212 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001308241, ENSMUSE00001279438, ENSMUSE00000864604 (exons 2, 3, and 4) and 4539 bp of intronic sequence including the splice acceptor and donor the start site and 3 UTR and is predicted to result in a null allele. There is a 3 bp deletion (GTC) 5 bases after the 3 coordinate. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Smim17 Mutation: 11 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)