Rr253^em1Kmm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr253^em1Kmm
• Name: regulatory region 253; endonuclease-mediated mutation 1, Kenneth M Murphy
• MGI ID: MGI:7331606
• Synonyms: Zeb2^delta-165
• Gene: Rr253 Location: Chr2:45169490-45169853 bp Genetic Position: Chr2, Syntenic
• Alliance: Rr253^em1Kmm page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The Zeb2 enhancer, containing four E-boxes and located ~165 kb upstream, was targeted with sgRNAs (targeting GAGAGATCATCAAATG and GATAACGTTCTTGAAGCATA) using CRISPR/Cas9 technology, resulting in a 364 bp deletion. (J:316113)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rr253 Mutation: 2 strains or lines available

References

• Original: J:316113 Huang X, et al., Differential usage of transcriptional repressor Zeb2 enhancers distinguishes adult and embryonic hematopoiesis. Immunity. 2021 Jul 13;54(7):1417-1432.e7
• All: 1 reference(s)