Rr253^em2Kmm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr253^em2Kmm
• Name: regulatory region 253; endonuclease-mediated mutation 2, Kenneth M Murphy
• MGI ID: MGI:7331607
• Synonyms: Zeb2^delta-165
• Gene: Rr253 Location: unknown Genetic Position: Chr2, Syntenic
• Alliance: Rr253^em2Kmm page

Mutation origin

• Strain of Origin: STOCK Zeb2^tm2.1Yhi/2YhiRbrc

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The Zeb2 enhancer, containing four E-boxes and located ~165 kb upstream, was targeted with sgRNAs (targeting GAGAGATCATCAAATG and GATAACGTTCTTGAAGCATA) using CRISPR/Cas9 technology, resulting in a 368 bp deletion. The allele was created in zygotes containing the Zeb2^tm2.1Yhi allele. (J:316113)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr253 Mutation: 2 strains or lines available

References

• Original: J:316113 Huang X, et al., Differential usage of transcriptional repressor Zeb2 enhancers distinguishes adult and embryonic hematopoiesis. Immunity. 2021 Jul 13;54(7):1417-1432.e7
• All: 1 reference(s)