Rr265^em1Maros
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr265^em1Maros
• Name: regulatory region 265; endonuclease-mediated mutation 1, Marian A Ros
• MGI ID: MGI:7333232
• Synonyms: deltaLARM2
• Gene: Rr265 Location: unknown Genetic Position: Chr2, Syntenic
• Alliance: Rr265^em1Maros page

Mutation origin

• Strain of Origin: C57BL/6 x CBA

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region, Null/knockout)
• Mutation: Intergenic deletion
• Mutation details: This Lmx1b-binding sites containing Lmx1b enhancer, driving expression in limbs, was targeted with sgRNAs (targeting TTCCCTTTTGAACCTTGCGG and CAGCCCCAGAATCTAGGCGC) using CRISPR/Cas9 technology, resulting in a deletion. (J:312494)

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr265 Mutation: 0 strains or lines available

References

• Original: J:312494 Haro E, et al., Identification of limb-specific Lmx1b auto-regulatory modules with Nail-patella syndrome pathogenicity. Nat Commun. 2021 Sep 20;12(1):5533
• All: 1 reference(s)