About   Help   FAQ
Del(2Rr263-Rr265)1Kco
Endonuclease-mediated Allele Detail
Summary
Symbol: Del(2Rr263-Rr265)1Kco
Name: deletion, Chr 2, Kerby C Oberg 1
MGI ID: MGI:7335222
Synonyms: deltaLARM1/2
Gene: Del(2Rr263-Rr265)1Kco  Location: unknown  Genetic Position: Chr2, Syntenic
Mutation
origin
Strain of Origin:  C57BL/6 x CBA
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region, Null/knockout)
Mutation:    Intergenic deletion
  Del(2Rr263-Rr265)1Kco involves 2 genes/genome features (Rr263, Rr264) View all
 
Mutation detailsA Lmx1b-binding sites containing Lmx1b enhancer and suppressor region, regulating expression in limbs, was targeted with sgRNAs (targeting TGGTCCCCAGATATTATGG and TTCCCTTTTGAACCTTGCGG) using CRISPR/Cas9 technology, resulting in a deletion. The deleted region contains enhancers Rr263 and Rr265, and suppressor Rr264. (J:312494)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 12 assay results
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Del(2Rr263-Rr265)1Kco Mutation:  0 strains or lines available
References
Original:  J:312494 Haro E, et al., Identification of limb-specific Lmx1b auto-regulatory modules with Nail-patella syndrome pathogenicity. Nat Commun. 2021 Sep 20;12(1):5533
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory