Del(2Rr263-Rr265)1Kco
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(2Rr263-Rr265)1Kco
• Name: deletion, Chr 2, Kerby C Oberg 1
• MGI ID: MGI:7335222
• Synonyms: deltaLARM1/2
• Gene: Del(2Rr263-Rr265)1Kco Location: unknown Genetic Position: Chr2, Syntenic

Mutation origin

• Strain of Origin: C57BL/6 x CBA

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region, Null/knockout)
• Mutation: Intergenic deletion
• Del(2Rr263-Rr265)1Kco involves 2 genes/genome features (Rr264, Rr263) View all
• Mutation details: A Lmx1b-binding sites containing Lmx1b enhancer and suppressor region, regulating expression in limbs, was targeted with sgRNAs (targeting TGGTCCCCAGATATTATGG and TTCCCTTTTGAACCTTGCGG) using CRISPR/Cas9 technology, resulting in a deletion. The deleted region contains enhancers Rr263 and Rr265, and suppressor Rr264. (J:312494)

Expression

In Mice Carrying this Mutation:	12 assay results
In Structures Affected by this Mutation:	4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(2Rr263-Rr265)1Kco Mutation: 0 strains or lines available

References

• Original: J:312494 Haro E, et al., Identification of limb-specific Lmx1b auto-regulatory modules with Nail-patella syndrome pathogenicity. Nat Commun. 2021 Sep 20;12(1):5533
• All: 2 reference(s)