Rr272^em2Mad
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr272^em2Mad
• Name: regulatory region 272; endonuclease-mediated mutation 2, Michael A Dyer
• MGI ID: MGI:7341373
• Synonyms: R0-37-R1-28 delta
• Gene: Rr272 Location: unknown Genetic Position: Chr12, Syntenic
• Alliance: Rr272^em2Mad page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Rr272^em2Mad involves 3 genes/genome features (Rr274, Rr273, Lin52) View all
• Mutation details: This Vsx2 enhancer was targeted with sgRNAs (GUUAGACCUAGUCAGAACUC and GUCUAGCUUGUGGAUUUCUU) and an ssODN template using CRISPR/Cas9 technology, resulting in a 11,634 bp deletion (chr12:84578824-84590457 GRCm39) that contains evolutionary conserved regions Rr273 and Rr274. (J:328714)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr272 Mutation: 0 strains or lines available

References

• Original: J:328714 Honnell V, et al., Identification of a modular super-enhancer in murine retinal development. Nat Commun. 2022 Jan 11;13(1):253
• All: 1 reference(s)