Rr274^em3Mad
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr274^em3Mad
• Name: regulatory region 274; endonuclease-mediated mutation 3, Michael A Dyer
• MGI ID: MGI:7341436
• Gene: Rr274 Location: unknown Genetic Position: Chr12, Syntenic
• Alliance: Rr274^em3Mad page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: This Vsx2 enhancer was targeted with sgRNAs (CCUGCCGAUAAUGCUUAAUU) and an ssODN template using CRISPR/Cas9 technology, resulting in the deletion of one of the Vsx2 consensus binding sites. (J:328714)

Expression

In Mice Carrying this Mutation:	1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr274 Mutation: 0 strains or lines available

References

• Original: J:328714 Honnell V, et al., Identification of a modular super-enhancer in murine retinal development. Nat Commun. 2022 Jan 11;13(1):253
• All: 1 reference(s)