Cfap107^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cfap107^em1(IMPC)J
• Name: cilia and flagella associated protein 107; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7343883
• Gene: Cfap107 Location: Chr4:144144759-144165342 bp, - strand Genetic Position: Chr4, 77.98 cM, cytoband E1
• Alliance: Cfap107^em1(IMPC)J page
• IMPC: Cfap107 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAGGACCACAGATGCACAG and TACCATTGCAGTTTACCCTG, which resulted in a 472 bp deletion beginning at Chromosome 4 position 144,419,612 bp and ending after 144,420,083 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000180466 (exon 3) and 294 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 77 and early truncation 8 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cfap107 Mutation: 10 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)