B4galnt4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: B4galnt4^em1(IMPC)J
• Name: beta-1,4-N-acetyl-galactosaminyl transferase 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7344348
• Gene: B4galnt4 Location: Chr7:140641017-140652313 bp, + strand Genetic Position: Chr7, 86.32 cM
• Alliance: B4galnt4^em1(IMPC)J page
• IMPC: B4galnt4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTCTGAGAGGATCACCAGA and AACATGGGCGAGGGTCAGGA, which resulted in a 1998 bp deletion beginning at Chromosome 7 position 141,063,569 bp and ending after 141,065,566 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000526246, ENSMUSE00000526245, ENSMUSE00000411875, ENSMUSE00000378279, ENSMUSE00000367568, ENSMUSE00000375760, and ENSMUSE00000350598 (exons 2-8) and 1363 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 13 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any B4galnt4 Mutation: 50 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)