Smim22^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Smim22^em1(IMPC)J
• Name: small integral membrane protein 22; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7345511
• Gene: Smim22 Location: Chr16:4825152-4826173 bp, + strand Genetic Position: Chr16, 2.49 cM
• Alliance: Smim22^em1(IMPC)J page
• IMPC: Smim22 gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GACTGTGTACGGCCAGAAAG and ACTGTGTTCTAATCCCGCCA, which resulted in a 643 bp deletion beginning at Chromosome 16 position 5,007,697 bp and ending after 5,008,339 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000997341, ENSMUSE00001018238, and ENSMUSE00001086134 (exons 2,3,4) and 296 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Smim22 Mutation: 5 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)