About   Help   FAQ
Rgs2em1Jgro
Endonuclease-mediated Allele Detail
Summary
Symbol: Rgs2em1Jgro
Name: regulator of G-protein signaling 2; endonuclease-mediated mutation 1, Justin Grobe
MGI ID: MGI:7346183
Synonyms: Rgs2flox
Gene: Rgs2  Location: Chr1:143875076-143879887 bp, - strand  Genetic Position: Chr1, 62.56 cM
Alliance: Rgs2em1Jgro page
Mutation
origin
Strain of Origin:  (C57BL/6J x SJL/J)F1/J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation detailsCRISPR/cas9 genome editing uses guide RNAs (ATGAGCTTTACAAGCAGGAT and GCTGGGATGAGAGGCGCACA) toinsert loxP sited in the introns flanking exons 2-4. Rgs2 transcript Rgs2-202 was used as reference for the exon number and the guide sequences. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rgs2 Mutation:  21 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory