Rr284^em1Zllr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr284^em1Zllr
• Name: regulatory region 284; endonuclease-mediated mutation 1, Rolf Zeller
• MGI ID: MGI:7346397
• Synonyms: CRM3^delta
• Gene: Rr284 Location: unknown Genetic Position: Chr2, Syntenic
• Alliance: Rr284^em1Zllr page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: This Grem1 limb regulatory region, located in Fmn1 intron 13 [in reference to ENSMUST00000081349], was targeted with sgRNAs (targeting CACCGCCTGTGATCCATCGAATGCC and AAACGGCATTCGATGGATCACAGGC) using CRISPR/Cas9 technology, resulting in an 8.3 kb deletion (chr2:113503131-113511422 GRCm39). (J:312378)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr284 Mutation: 0 strains or lines available

References

• Original: J:312378 Malkmus J, et al., Spatial regulation by multiple Gremlin1 enhancers provides digit development with cis-regulatory robustness and evolutionary plasticity. Nat Commun. 2021 Sep 21;12(1):5557
• All: 1 reference(s)