Fmn1em1Zllr
Endonuclease-mediated Allele Detail
|
Symbol: |
Fmn1em1Zllr |
Name: |
formin 1; endonuclease-mediated mutation 1, Rolf Zeller |
MGI ID: |
MGI:7346402 |
Synonyms: |
EC1delta |
Gene: |
Fmn1 Location: Chr2:113158081-113547112 bp, + strand Genetic Position: Chr2, 57.3 cM, cytoband C1-qter
|
Alliance: |
Fmn1em1Zllr page
|
|
Strain of Origin: |
Not Applicable
|
|
Allele Type: |
|
Endonuclease-mediated (Modified regulatory region, Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Fmn1em1Zllr involves 3 genes/genome features (Rr26, Rr284, Rr285)
View all
|
|
|
Mutation details: An enhancer cluster containing Grem1 limb regulatory regions Rr285 (CRM2), Rr284 (CRM3) and Rr26 (CRM4), located in Fmn1 introns 15 and 13 [in reference to ENSMUST00000081349], was targeted with sgRNAs (targeting CACCGTGGCTTACCAGACTAGCGGT and CACCGAATGGTCTGATCGCCA) using CRISPR/Cas9 technology, resulting in a 71.2 kb deletion (chr2:113467121-113538319 GRCm39) from intron 13 to 16 (so including exons 14-16).
(J:312378)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Fmn1 Mutation: |
75 strains or lines available
|
|
Original: |
J:312378 Malkmus J, et al., Spatial regulation by multiple Gremlin1 enhancers provides digit development with cis-regulatory robustness and evolutionary plasticity. Nat Commun. 2021 Sep 21;12(1):5557 |
All: |
1 reference(s) |
|