About   Help   FAQ
Fmn1em1Zllr
Endonuclease-mediated Allele Detail
Summary
Symbol: Fmn1em1Zllr
Name: formin 1; endonuclease-mediated mutation 1, Rolf Zeller
MGI ID: MGI:7346402
Synonyms: EC1delta
Gene: Fmn1  Location: Chr2:113158081-113547112 bp, + strand  Genetic Position: Chr2, 57.3 cM, cytoband C1-qter
Alliance: Fmn1em1Zllr page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region, Null/knockout)
Mutation:    Intragenic deletion
  Fmn1em1Zllr involves 3 genes/genome features (Rr26, Rr284, Rr285) View all
 
Mutation detailsAn enhancer cluster containing Grem1 limb regulatory regions Rr285 (CRM2), Rr284 (CRM3) and Rr26 (CRM4), located in Fmn1 introns 15 and 13 [in reference to ENSMUST00000081349], was targeted with sgRNAs (targeting CACCGTGGCTTACCAGACTAGCGGT and CACCGAATGGTCTGATCGCCA) using CRISPR/Cas9 technology, resulting in a 71.2 kb deletion (chr2:113467121-113538319 GRCm39) from intron 13 to 16 (so including exons 14-16). (J:312378)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Fmn1 Mutation:  75 strains or lines available
References
Original:  J:312378 Malkmus J, et al., Spatial regulation by multiple Gremlin1 enhancers provides digit development with cis-regulatory robustness and evolutionary plasticity. Nat Commun. 2021 Sep 21;12(1):5557
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory