Fmn1^em1Zllr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fmn1^em1Zllr
• Name: formin 1; endonuclease-mediated mutation 1, Rolf Zeller
• MGI ID: MGI:7346402
• Synonyms: EC1^delta
• Gene: Fmn1 Location: Chr2:113158081-113547112 bp, + strand Genetic Position: Chr2, 57.3 cM, cytoband C1-qter
• Alliance: Fmn1^em1Zllr page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region, Null/knockout)
• Mutation: Intragenic deletion
• Fmn1^em1Zllr involves 3 genes/genome features (Rr285, Rr284, Rr26) View all
• Mutation details: An enhancer cluster containing Grem1 limb regulatory regions Rr285 (CRM2), Rr284 (CRM3) and Rr26 (CRM4), located in Fmn1 introns 15 and 13 [in reference to ENSMUST00000081349], was targeted with sgRNAs (targeting CACCGTGGCTTACCAGACTAGCGGT and CACCGAATGGTCTGATCGCCA) using CRISPR/Cas9 technology, resulting in a 71.2 kb deletion (chr2:113467121-113538319 GRCm39) from intron 13 to 16 (so including exons 14-16). (J:312378)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Fmn1 Mutation: 76 strains or lines available

References

• Original: J:312378 Malkmus J, et al., Spatial regulation by multiple Gremlin1 enhancers provides digit development with cis-regulatory robustness and evolutionary plasticity. Nat Commun. 2021 Sep 21;12(1):5557
• All: 1 reference(s)