Gpn1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gpn1^em1(IMPC)J
• Name: GPN-loop GTPase 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7356629
• Synonyms: Gpn1^-
• Gene: Gpn1 Location: Chr5:31652085-31670248 bp, + strand Genetic Position: Chr5, 17.27 cM
• Alliance: Gpn1^em1(IMPC)J page
• IMPC: Gpn1 gene page

Gpn1^em1(IMPC)J/Gpn1^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts fail to hatch from the zona pellucida and die after 3 days in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTCTTCCTGGGGTACTACT and TGACGTGGAGAAACTTTCAG, which resulted in a 2433 bp deletion beginning at Chromosome 5 position 31,497,093 bp and ending after 31,499,525 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001228555, ENSMUSE00001229512, and ENSMUSE00001247942 (exons 3,4, and 5) and 2282 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 69 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gpn1 Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)