Rr295^em1Hzo
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr295^em1Hzo
• Name: regulatory region 295; endonuclease-mediated mutation 1, Huda Y Zoghbi
• MGI ID: MGI:7356640
• Synonyms: Peak-2^KO
• Gene: Rr295 Location: ChrX:73088588-73089741 bp Genetic Position: ChrX, Syntenic
• Alliance: Rr295^em1Hzo page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: The Mecp2 enhancer in intron 1 was targeted with sgRNAs (targeting ACATGCACAAACCCAAACAT and TGATAAGTGTGATTCATGAG) using CRISPR/Cas9 technology, resulting in an 1154 bp deletion. (J:311942)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr295 Mutation: 0 strains or lines available

References

• Original: J:311942 Shao Y, et al., Identification and characterization of conserved noncoding cis-regulatory elements that impact Mecp2 expression and neurological functions. Genes Dev. 2021 Apr 1;35(7-8):489-494
• All: 1 reference(s)