Dmrt1^em1Zark
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dmrt1^em1Zark
• Name: doublesex and mab-3 related transcription factor 1; endonuclease-mediated mutation 1, David Zarkower
• MGI ID: MGI:7366910
• Synonyms: Dmrt1^R111G
• Gene: Dmrt1 Location: Chr19:25483070-25581692 bp, + strand Genetic Position: Chr19, 20.45 cM, cytoband C2-C3
• Alliance: Dmrt1^em1Zark page

Mutation origin

• Strain of Origin: (FVB/NJ x B6(Cg)-Tyr^c-2J/J)F1

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/cas9 endonuclease-mediated genome editing was used to create asparagine to glycine substitution at position 109 (R109G in the mouse, R111G in human) the using Ensembl Canonical Transcript: ENSMUST00000025755.11 Dmrt1-201. The CRISPR guide sequence was CCCGCTGTCGCTCCGCAATC and the repair template was 5'-GGCCACAAGCGCTTCTGCATGTGGCGGGATTGCCAGTGCAAGAAGTGCAGTCTGATCGCGGAGGGACAGCGGGTGATGGCCGCGCAGGTGGCCCTGAGAAGACAGCAGGCCCA-3'. The repair template includes two silent changes that remove the PAM sequence and generate a restriction enzyme recognition site, as well as R109G. The R109G mutation alters the DNA binding motif. The mutation models a de novo human mutation in DMRT1 associated with dominant complete gonadal dysgenesis and 46,XY sex reversal. (J:330224)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dmrt1 Mutation: 48 strains or lines available

References

• Original: J:330224 Murphy MW, et al., Genomics of sexual cell fate transdifferentiation in the mouse gonad. G3 (Bethesda). 2022 Oct 6
• All: 1 reference(s)