Del(4Nppb-Nppa)4Vmc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(4Nppb-Nppa)4Vmc
• Name: deletion, Chr4, Vincent M Christoffels 4
• MGI ID: MGI:7366921
• Synonyms: Nppa-Nppb^-, Nppa-Nppb dKO
• Gene: Del(4Nppb-Nppa)4Vmc Location: unknown Genetic Position: Chr4, Syntenic

Mutation origin

• Strain of Origin: FVB/NRj

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region, Null/knockout)
• Mutations: Intergenic deletion, Intragenic deletion
• Mutation details: The Nppa and Nppb genes were targeted with sgRNAs (targeting GACTACATGGCAGATCACCC and GGCCAGTTCAAACGATTTGT) using CRISPR/Cas9 technology, resulting in the deletion of both genes and enhancer Rr103616 in-between, as well as the 3' end of the Gm13054 lncRNA gene. (J:309962)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(4Nppb-Nppa)4Vmc Mutation: 0 strains or lines available

References

• Original: J:309962 Man JCK, et al., Genetic Dissection of a Super Enhancer Controlling the Nppa-Nppb Cluster in the Heart. Circ Res. 2021 Jan 8;128(1):115-129
• All: 1 reference(s)