Rr303^em1Vave
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr303^em1Vave
• Name: regulatory region 303; endonuclease-mediated mutation 1, Vasanth Vedantham
• MGI ID: MGI:7367219
• Synonyms: Isl1^deltaISE
• Gene: Rr303 Location: unknown Genetic Position: Chr13, Syntenic
• Alliance: Rr303^em1Vave page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The Isl1 sinoatrial node enhancer was targeted with sgRNAs (targeting TTGGAGAAAATCGAATACCC, CCCCAAACACAATATAGTAG, GCCAGTAATGTACTTCACTG and AGGGTGTGCACACTTACACA) using CRISPR/Cas9 technology, resulting in a 2762 bp deletion. (J:308878)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr303 Mutation: 0 strains or lines available

References

• Original: J:308878 Galang G, et al., ATAC-Seq Reveals an Isl1 Enhancer That Regulates Sinoatrial Node Development and Function. Circ Res. 2020 Dec 4;127(12):1502-1518
• All: 1 reference(s)