Rr115^em1Bobh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr115^em1Bobh
• Name: regulatory region 115; endonuclease-mediated mutation 1, Robert E Hill
• MGI ID: MGI:7367576
• Synonyms: Shh^deltaSBE2
• Gene: Rr115 Location: unknown Genetic Position: Chr5, Syntenic
• Alliance: Rr115^em1Bobh page

Mutation origin

• Strain of Origin: (C57BL/6J x CBA)F2

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: Shh brain enhancer 2 (SBE2) was targeted with sgRNAs (targeting AAACACATTAAAGCCCTCCAGCG, CACCGACGCTGGAGGGCTTTAATGT, AAACACGAGCAAGCCAACCGGAGG and CACCGCTCCGGTTGGCTTGCTCGT) using CRISPR/Cas9 technology, resulting in a 1.2 kb deletion. (J:306254)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr115 Mutation: 0 strains or lines available

References

• Original: J:306254 Crane-Smith Z, et al., A Highly Conserved Shh Enhancer Coordinates Hypothalamic and Craniofacial Development. Front Cell Dev Biol. 2021;9:595744
• All: 1 reference(s)