Ccdc32^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc32^em1(IMPC)J
• Name: coiled-coil domain containing 32; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7378567
• Gene: Ccdc32 Location: Chr2:118848260-118859874 bp, - strand Genetic Position: Chr2, 59.82 cM
• Alliance: Ccdc32^em1(IMPC)J page
• IMPC: Ccdc32 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTACCATTTATAAACAAGA and GCACGCTTCTGTGTTGAACT, which resulted in a 440 bp deletion beginning at Chromosome 2 position 119,026,982 bp and ending after 119,027,421 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000356296 (exon 1) and 190 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ccdc32 Mutation: 8 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)