Eml3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Eml3^em1(IMPC)J
• Name: echinoderm microtubule associated protein like 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7386926
• Gene: Eml3 Location: Chr19:8906916-8918946 bp, + strand Genetic Position: Chr19, 6.04 cM
• Alliance: Eml3^em1(IMPC)J page
• IMPC: Eml3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAGTCAGCCTGCTAATGTG and GAACTACAGGAGTTCTAACG, which resulted in a 2241 bp deletion beginning at Chromosome 19 position 8,932,972 bp and ending after 8,935,212 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000621540, ENSMUSE00000621539, ENSMUSE00000621538, ENSMUSE00000621537, ENSMUSE00000621536, and ENSMUSE00000621535 (exons 5-10) and 1601 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 189 and early truncation 127 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Eml3 Mutation: 44 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)