Tjap1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tjap1^em1(IMPC)J
• Name: tight junction associated protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7386930
• Gene: Tjap1 Location: Chr17:46568777-46593952 bp, - strand Genetic Position: Chr17, 22.9 cM
• Alliance: Tjap1^em1(IMPC)J page
• IMPC: Tjap1 gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTGTGGCCACAACATAGCG and GGGTTACTAAATAAAGTCAG, which resulted in a 468 bp deletion beginning at Chromosome 17 position 46,260,872 bp and ending after 46,261,339 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000136628 (exon 8) and 401 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 97 and early truncation 17 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tjap1 Mutation: 47 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)