About   Help   FAQ
Tjap1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tjap1em1(IMPC)J
Name: tight junction associated protein 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7386930
Gene: Tjap1  Location: Chr17:46568777-46593952 bp, - strand  Genetic Position: Chr17, 22.9 cM
Alliance: Tjap1em1(IMPC)J page
IMPC: Tjap1 gene page
Mutation
origin
Strain of Origin:  Not Applicable
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTGTGGCCACAACATAGCG and GGGTTACTAAATAAAGTCAG, which resulted in a 468 bp deletion beginning at Chromosome 17 position 46,260,872 bp and ending after 46,261,339 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000136628 (exon 8) and 401 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 97 and early truncation 17 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tjap1 Mutation:  47 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory