Dp(11)2Smun
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dp(11)2Smun
• Name: duplication, Chr 11, Stefan Mundlos 2
• MGI ID: MGI:7398591
• Synonyms: Dup-LdeltaBor
• Gene: Dp(11)2Smun Location: unknown Genetic Position: Chr11, Syntenic

Mutation origin

• Strain of Origin: 129P2/OlaHsd

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Modified regulatory region, Reporter)
• Mutations: Duplication, Insertion
• Mutation details: This duplication allele was created through cre-mediated interchromosomal recombination between loxP sites on two alleles: allele Igs44^{tm1(sb-SBlac)Smun} containing an SBlac cassette at chr11:110989101-110989102 (GRCm39), and allele Igs45^{tm1(sb-SBlac)Smun} containing an SBlac cassette at chr11:112544204-112544205. The duplicated sequence contains boundary region (insulator) Rr325 between the topologically associated domains (TADs) that contain the Kcnj16 and Kcnj2 genes and Sox9, respectively. It duplicates most of the Sox9 TAD and less than half of the Kcnj TAD but leaves the genes intact. The recombination between the loxP sites in the two SBlac cassettes leaves one intact cassette at the duplication junction. Subsequent to the duplication, the allele was subjected to targeting both copies of Rr325 with sgRNAs (targeting GATCATTTTAGGTAACGACCC and GATTTAGCGTCCCCTAGCATA) using CRISPR/Cas9 technology, resulting in two 18.342 kb deletions (chr11:111413371-111431712 (GRCm39) for the original insulator). (J:235642)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Dp(11)2Smun Mutation: 0 strains or lines available

References

• Original: J:235642 Franke M, et al., Formation of new chromatin domains determines pathogenicity of genomic duplications. Nature. 2016 Oct 13;538(7624):265-269
• All: 1 reference(s)