Igs47^{em1(Rr325)Smun}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Igs47^{em1(Rr325)Smun}
• Name: intergenic sequence 47; endonuclease-mediated mutation 1, Stefan Mundlos
• MGI ID: MGI:7407293
• Synonyms: Bor-Knockin
• Gene: Igs47 Location: unknown Genetic Position: Chr11, Syntenic
• Alliance: Igs47^{em1(Rr325)Smun} page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:282642
• Parent Cell Line: G4 (ES Cell)
• Strain of Origin: (129S6/SvEvTac x C57BL/6NCrl)F1

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Insertion
• Mutation details: A 6.3 kb sequence, containing the border (insulator) region between the Kcnj and Sox9 topologically associated domains (TADs), was targeted for insertion in Rr325^em1Smun Rr325 deletion allele ES cells about 125 kb upstream of Sox9 with an sgRNA (targeting GGAGGGACACTGATATTTCT) using CRISPR/Cas9 technology. (J:282642)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Igs47 Mutation: 0 strains or lines available

References

• Original: J:282642 Despang A, et al., Functional dissection of the Sox9-Kcnj2 locus identifies nonessential and instructive roles of TAD architecture. Nat Genet. 2019 Aug;51(8):1263-1271
• All: 1 reference(s)