In(11Rr325)1Smun
Endonuclease-mediated Allele Detail

Summary

• Symbol: In(11Rr325)1Smun
• Name: inversion, Chr 11, Stefan Mundlos 1
• MGI ID: MGI:7407294
• Synonyms: InvC
• Gene: In(11Rr325)1Smun Location: unknown Genetic Position: Chr11, Syntenic

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutations: Insertion, Inversion
• In(11Rr325)1Smun involves 1 genes/genome features (Rr325) View all
• Mutation details: The centromeric part of the Sox9 topologically associated domain (TAD), including border (insulator) region Rr325 that separates it from the Kcnj TAD, was targeted with sgRNAs (targeting ATCATTTTAGGTAACGACCC and GAAGCAAATACGTGAGTCTAC) using CRISPR/Cas9 technology, resulting in its inversion. (J:282642)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any In(11Rr325)1Smun Mutation: 0 strains or lines available

References

• Original: J:282642 Despang A, et al., Functional dissection of the Sox9-Kcnj2 locus identifies nonessential and instructive roles of TAD architecture. Nat Genet. 2019 Aug;51(8):1263-1271
• All: 1 reference(s)