In(11)3Smun
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
In(11)3Smun |
| Name: |
inversion, Chr 11, Stefan Mundlos 3 |
| MGI ID: |
MGI:7407296 |
| Synonyms: |
Inv-Intra |
| Gene: |
In(11)3Smun Location: unknown Genetic Position: Chr11, Syntenic
|
|
| Strain of Origin: |
Not Applicable
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutations: |
|
Insertion, Inversion
|
| |
|
Mutation details: The centromeric part of the Sox9 topologically associated domain (TAD), excluding border (insulator) region Rr325 that separates it from the Kcnj TAD, was targeted with sgRNAs (targeting ATTTAGCGTCCCCTAGCATA and GAAGCAAATACGTGAGTCTAC) using CRISPR/Cas9 technology, resulting in its inversion.
(J:282642)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any In(11)3Smun Mutation: |
0 strains or lines available
|
|
| Original: |
J:282642 Despang A, et al., Functional dissection of the Sox9-Kcnj2 locus identifies nonessential and instructive roles of TAD architecture. Nat Genet. 2019 Aug;51(8):1263-1271 |
| All: |
1 reference(s) |
|
Analysis Tools
