Hs1bp3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hs1bp3^em1(IMPC)J
• Name: HCLS1 binding protein 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7408175
• Gene: Hs1bp3 Location: Chr12:8363432-8393824 bp, + strand Genetic Position: Chr12, 3.85 cM
• Alliance: Hs1bp3^em1(IMPC)J page
• IMPC: Hs1bp3 gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTTCGTCTGACGTTCCCCA and AGACCTTGAACAAATGACAT, which resulted in a 463 bp deletion beginning at Chromosome 12 position 8,373,662 bp and ending after 8,374,124 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000106987 (exon 4) and 231 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 135 and early truncation 12 amino acids later. (J:188991)
• Inheritance: Not Specified

Phenotypes

Key:

hm	homozygous	ht	heterozygous	tg	involves transgenes	√	phenotype observed
cn	conditional genotype	cx	complex: > 1 genome feature	ot	other: hemizygous, indeterminate,...	N	normal phenotype

Genotype/
Background:

	Allelic Composition	Genetic Background	Cell Line(s)
Loading...
hm1	Hs1bp3^em1(IMPC)J/Hs1bp3^em1(IMPC)J	C57BL/6NJ-Hs1bp3^em1(IMPC)J/Mmjax

Phenotypes:

Affected Systems	hm1
show or hide all annotated terms Sex:
Source:	IMPC - JAX
hematopoietic system	√
decreased leukocyte cell number	√
immune system	√
decreased leukocyte cell number	√

View phenotypes and curated references for all genotypes (concatenated display).

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Hs1bp3 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)