About   Help   FAQ
Prr30em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Prr30em1(IMPC)J
Name: proline rich 30; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7408180
Gene: Prr30  Location: Chr14:101435126-101437766 bp, - strand  Genetic Position: Chr14, 50.9 cM, cytoband E2.2
Alliance: Prr30em1(IMPC)J page
IMPC: Prr30 gene page
Mutation
origin
Strain of Origin:  Not Applicable
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTACTCAAGTGATAGCAGT and GAGCACCTGAAGCAGAATCC, which resulted in a 1970 bp deletion beginning at Chromosome 14 position 101,435,012 bp and ending after 101,436,981 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000364724 (exon 3) and 175 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Prr30 Mutation:  11 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory