Rr307328^em1Fsp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr307328^em1Fsp
• Name: regulatory region 307328; endonuclease-mediated mutation 1, Francois Spitz
• MGI ID: MGI:7410984
• Synonyms: Myc^deltaD
• Gene: Rr307328 Location: Chr15:63529401-63531200 bp, . strand Genetic Position: Chr15, Syntenic
• Alliance: Rr307328^em1Fsp page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: Myc blood enhancer cluster (BENC) sequence D was targeted with sgRNAs (targeting CCAGGGGTTAACTATCCAGA) and GCTGGCGCCAGCCATGTTC) using CRISPR/Cas9 technology, resulting in its deletion (chr15:63529721-63530699 (GRCm39)). (J:257739)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr307328 Mutation: 0 strains or lines available

References

• Original: J:257739 Bahr C, et al., A Myc enhancer cluster regulates normal and leukaemic haematopoietic stem cell hierarchies. Nature. 2018 Jan 25;553(7689):515-520
• All: 1 reference(s)