B4galt4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: B4galt4^em1(IMPC)J
• Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7411374
• Gene: B4galt4 Location: Chr16:38562626-38589411 bp, + strand Genetic Position: Chr16, 26.87 cM, cytoband B4
• Alliance: B4galt4^em1(IMPC)J page
• IMPC: B4galt4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGGTTGTAATCGGAGCCG and TTGCCCATACTCTTATTAGA, which resulted in a 807 bp deletion beginning at Chromosome 16 position 38,753,882 bp and ending after 38,754,688 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000130477 (exon 3) and 574 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 84 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any B4galt4 Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)