Alg12^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Alg12^em1(IMPC)J
• Name: ALG12 alpha-1,6-mannosyltransferase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7425011
• Gene: Alg12 Location: Chr15:88689448-88703498 bp, - strand Genetic Position: Chr15, 44.3 cM
• Alliance: Alg12^em1(IMPC)J page
• IMPC: Alg12 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTAAAAGTACCTATCACCC and CTGAAAGGAAGTCAGAGGCG, which resulted in a 4434 bp deletion beginning at Chromosome 15 position 88,811,214 bp and ending after 88,815,647 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000312413, ENSMUSE00001295588, ENSMUSE00001230922, and ENSMUSE00001279793 (exons 4-7) and 3737 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 99 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Alg12 Mutation: 35 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)