Calhm4^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Calhm4^em1(IMPC)Tcp
• Name: calcium homeostasis modulator family member 4; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7425554
• Gene: Calhm4 Location: Chr10:33914780-33920306 bp, - strand Genetic Position: Chr10, 18.85 cM
• Alliance: Calhm4^em1(IMPC)Tcp page
• IMPC: Calhm4 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGTGTTGCTCGGCTCGATAC and AGAGGGCTGCTTCTCCGGTA traversing the critical region (ENSMUSE00000316881 and ENSMUSE00000371215). This resulted in a 2794-bp deletion of Chr10 from 33,917,226 to 33,920,020 with insertion of TACCC (GRCm39). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Calhm4 Mutation: 9 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)