About   Help   FAQ
Mov10em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Mov10em1(IMPC)Tcp
Name: Mov10 RISC complex RNA helicase; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:7425836
Gene: Mov10  Location: Chr3:104702152-104725879 bp, - strand  Genetic Position: Chr3, 45.87 cM, cytoband F2
Alliance: Mov10em1(IMPC)Tcp page
IMPC: Mov10 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGTGGTGCTAGGATAACCTA targeting the 5' side and TATAGGCACATTCAGCTCGC targeting the 3' side of a critical region (ENSMUSE00000173482, ENSMUSE00000173486, ENSMUSE00000173485, ENSMUSE00000173480 and ENSMUSE00000173487) along with a single-strand oligonucleotide encoding a Bxb1 attB site. This resulted in a 3,107-bp deletion (Chr3:104,707,954 to 104,711,060, GRCm39) with an insertion of a Bxb1 attB sequence (GGCTTGTCGACGACGGCGGTCTCCGTCGTCAGGATCATACACCGGT). (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Mov10 Mutation:  76 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory