Mov10^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mov10^em1(IMPC)Tcp
• Name: Mov10 RISC complex RNA helicase; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7425836
• Gene: Mov10 Location: Chr3:104702152-104725879 bp, - strand Genetic Position: Chr3, 45.87 cM, cytoband F2
• Alliance: Mov10^em1(IMPC)Tcp page
• IMPC: Mov10 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGTGGTGCTAGGATAACCTA targeting the 5' side and TATAGGCACATTCAGCTCGC targeting the 3' side of a critical region (ENSMUSE00000173482, ENSMUSE00000173486, ENSMUSE00000173485, ENSMUSE00000173480 and ENSMUSE00000173487) along with a single-strand oligonucleotide encoding a Bxb1 attB site. This resulted in a 3,107-bp deletion (Chr3:104,707,954 to 104,711,060, GRCm39) with an insertion of a Bxb1 attB sequence (GGCTTGTCGACGACGGCGGTCTCCGTCGTCAGGATCATACACCGGT). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mov10 Mutation: 76 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)