Ubr7^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ubr7^em1(IMPC)Tcp
• Name: ubiquitin protein ligase E3 component n-recognin 7 (putative); endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7426069
• Gene: Ubr7 Location: Chr12:102724234-102743960 bp, + strand Genetic Position: Chr12, 52.19 cM, cytoband F1
• Alliance: Ubr7^em1(IMPC)Tcp page
• IMPC: Ubr7 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CCTTCCCTCTTCCGTTATGC targeting the 5' side and GGACTGGTTGGGAGCCTACC targeting the 3' side of a critical region (ENSMUSE00000259884, ENSMUSE00000259878, ENSMUSE00000259867, ENSMUSE00000343370 & ENSMUSE00000115512) along with a single-strand oligonucleotide encoding a Bxb1 attB site. This resulted in a 5,617-bp deletion of Chr12 from 102,727,155 to 102,732,771 (GRCm39) with insertion of the attB sequence (GGCTTGTCGACGACGGCGGTCTCCGTCGTCAGGATCATACACCGG). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ubr7 Mutation: 51 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)