Trim10^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trim10^em1(IMPC)J
• Name: tripartite motif-containing 10; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7427727
• Gene: Trim10 Location: Chr17:37180466-37188725 bp, + strand Genetic Position: Chr17, 19.16 cM
• Alliance: Trim10^em1(IMPC)J page
• IMPC: Trim10 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTTACTGCCTAACCTTGGG and CTTTTTCTAACAAGGCCTTG, which resulted in a 1354 bp deletion beginning at Chromosome 17 position 36,872,172 bp and ending after 36,873,525 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000357218 and ENSMUSE00000657361 (exons 3 and 4) and 1100 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 175 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Trim10 Mutation: 27 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)