About   Help   FAQ
Ccdc93em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc93em1(IMPC)J
Name: coiled-coil domain containing 93; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7427746
Synonyms: Ccdc93-
Gene: Ccdc93  Location: Chr1:121358796-121434189 bp, + strand  Genetic Position: Chr1, 52.97 cM, cytoband E2
Alliance: Ccdc93em1(IMPC)J page
IMPC: Ccdc93 gene page
Ccdc93em1(IMPC)J/Ccdc93em1(IMPC)J mice exhibit embryonic lethality between E7.5 and E9.5, growth retardation, poorly organized extraembryonic tissues, failure of primitive streak formation and gastrulation, and increased cell death.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACATGCATGTAAGGTCACAA and AAGAATCCCTGTCAGCTGCG, which resulted in a 328 bp deletion beginning at Chromosome 1 position 121,441,594 bp and ending after 121,441,921 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261988 (exon 4) and 216 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 84 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ccdc93 Mutation:  54 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/24/2024
MGI 6.24
The Jackson Laboratory