Ccdc93^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc93^em1(IMPC)J
• Name: coiled-coil domain containing 93; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7427746
• Synonyms: Ccdc93^-
• Gene: Ccdc93 Location: Chr1:121358796-121434189 bp, + strand Genetic Position: Chr1, 52.97 cM, cytoband E2
• Alliance: Ccdc93^em1(IMPC)J page
• IMPC: Ccdc93 gene page

Ccdc93^em1(IMPC)J/Ccdc93^em1(IMPC)J mice exhibit embryonic lethality between E7.5 and E9.5, growth retardation, poorly organized extraembryonic tissues, failure of primitive streak formation and gastrulation, and increased cell death.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACATGCATGTAAGGTCACAA and AAGAATCCCTGTCAGCTGCG, which resulted in a 328 bp deletion beginning at Chromosome 1 position 121,441,594 bp and ending after 121,441,921 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261988 (exon 4) and 216 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 84 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ccdc93 Mutation: 54 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)